Lowyat.NET: Latest topics by patrick chia

Credit Card recommandation

Thu, 01 Jan 1970 07:30:00 +0800

Credit Card recommandation

patrick chia — Wed, 23 Sep 2009 12:36:46 +0800

Hi,
I would like to register a credit card.
Can anyone give me suggestion that which bank's credit card is the best?
I prefer no annual fee and any extra fee for my credit card and can help me save money when purchase something one?
Thanks a lot for your suggestion

Merge two different file based on same contents.

patrick chia — Fri, 03 Apr 2009 12:32:00 +0800

hi,
I got some problems about how to merge the two different file based on same contents.
for example:
file 1:
1234 Ali guy
2345 Pink girl
3456 Alian guy

file 2:
1234 Ali guy USA
1111 Abu guy UK
2345 Pink girl UK
3456 Alian guy INDIA

output result:
1234 Ali guy USA
2345 Pink girl UK
3456 Alian guy INDIA

How can I get the desired output based on the same content of first three column of file 1 and file 2?
Anybody got any suggestions?
Thanks a lot.

Merge two different file based on same contents.

patrick chia — Fri, 03 Apr 2009 12:31:29 +0800

Find out the same content of two different files..

patrick chia — Thu, 02 Apr 2009 12:40:05 +0800

Hi,
I have two different files named as : file 1 and file 2
Each file contains ten columns contents.
By comparing between these two files, how can I found out the same content between this two different files by using command line? (I just want to find out those contents that exactly same at the first three column, $1,$2,$3 of the two different files)
My senior got advised me using the awk or perl.
Who else got the idea to generate my desired output result by awk, perl or any other command line?

Find out the same content of two different files..

patrick chia — Thu, 02 Apr 2009 12:39:45 +0800

Hi,
I have two different files named as : file 1 and file 2
Each file contains ten columns contents.
By comparing between these two files, how can I found out the same content between this two different files by using command line? (I just want to find out those contents that exactly same at the first three column, $1,$2,$3 of the two different files)
My senior got advised me using the awk or perl.
Who else got the idea to generate my desired output result by awk, perl or any other command line?

Summarizes the difference of the four mains contro

patrick chia — Wed, 01 Apr 2009 12:14:26 +0800

Hi, I'm fresh to UNIX script written. Can anybody briefly summarize the main differences between "if.then.elif.else", "do.while", "for", "case" in UNIX script?

Summarizes the difference of the four mains contro

patrick chia — Wed, 01 Apr 2009 12:14:06 +0800

Hi, I'm fresh to UNIX script written. Can anybody briefly summarize the main differences between "if.then.elif.else", "do.while", "for", "case" in UNIX script?

Challenging Question about grep and awk in UNIX...

patrick chia — Mon, 23 Mar 2009 15:15:54 +0800

if I have a file contains:
Input:
2406306 10087720 T,>,G S1,S2,S3
42406306 10126312 T,>,C S1,S2,S3,S6,S7,S8,S9
42406306 10363280 G,>,T S1,S2,S3,S10,S11,S12
42406306 10363297 T,>,C S1,S3
42406306 1040544 T,>,C S1,S2,S3,S6

Output:
2406306 10087720 T,>,G S1,S2,S3
42406306 10126312 T,>,C S1,S2,S3,S6,S7,S8,S9
42406306 1040544 T,>,C S1,S2,S3,S6

What command line I should type to let the output selected the lines at least must contains S1,S2,S3 but exludes any from S10-S12?
I got ask my senior and she advised that grep and awk can function it.
I have used:
awk '/S1,.*S2.*S3/' file
the above command line is worked. Do they still have any others command line that can generate the desired output result.
Thanks a lot for all advises.

Challenging Question about grep and awk in UNIX...

patrick chia — Mon, 23 Mar 2009 15:14:29 +0800

if I have a file contains:
Input:
2406306 10087720 T,>,G S1,S2,S3
42406306 10126312 T,>,C S1,S2,S3,S6,S7,S8,S9
42406306 10363280 G,>,T S1,S2,S3,S10,S11,S12
42406306 10363297 T,>,C S1,S3
42406306 1040544 T,>,C S1,S2,S3,S6

Output:
2406306 10087720 T,>,G S1,S2,S3
42406306 10126312 T,>,C S1,S2,S3,S6,S7,S8,S9
42406306 1040544 T,>,C S1,S2,S3,S6

What command line I should type to let the output selected the lines at least must contains S1,S2,S3 but exludes any from S10-S12?
I got ask my senior and she advised that grep and awk can function it.
I have used:
awk '/S1,.*S2.*S3/' file
the above command line is worked. Do they still have any others command line that can generate the desired output result.
Thanks a lot for all advises.

Glimmer3.0 problem....

patrick chia — Fri, 20 Mar 2009 16:14:06 +0800

Hi,
Glimmer is a collection of programs for identifying genes in microbial DNA sequences.
For running the glimmer requires 4 steps:
1. long-orfs USAGE: ./long-orfs <genome-file> [options]
2. extract Usages: extract genome_file coord_file
3. build-icm USAGE: build-icm [options]
4. glimmer3 USAGE: glimmer3 <genome-file> <icm-file> [options]
For example, I have one file named as tpall.fna. What command line I should type for running the glimmer3.0 step by step?

ps: what is the general command line that we should type to get use the Glimmer3.0 to find out the gene in microbial DNA sequences.

Thanks a lot...

Glimmer3.0 problem....

patrick chia — Fri, 20 Mar 2009 16:13:42 +0800

UNIX: Count poly A. Awk and sed is recommanded.

patrick chia — Mon, 16 Feb 2009 12:51:58 +0800

My input:
AAAAATTTTGGGCCC
AAAAAATT
AAAAAAACCCCCCA
AAAAAAAATTTTTGGGGGCCCCC

My output:
AAAAA = 1
AAAAAA = 1
AAAAAAA = 1
AAAAAAAA = 1

Actually I got use the grep command line to find out the poly A in my input sequence.
The command line I used is:
grep 'AAAAA' inputfiles | wc -l
grep 'AAAAAA' inputfiles | wc -l
grep 'AAAAAAA' inputfiles | wc -l
grep 'AAAAAAAA' inputfiles | wc -l

My senior got advise me to use awk or sed. Any UNIX expert have the idea about use the awk or sed to find out the poly A in my input file? Thanks for all of your advise. Have a nice day.

UNIX:Count poly A. Awk and sed are recommanded.

patrick chia — Mon, 16 Feb 2009 12:50:50 +0800

UNIX command line to solve the MEDIAN problem

patrick chia — Tue, 03 Feb 2009 10:32:02 +0800

My input:
10
15
20

My desired output:
Median = 15

**From the three figures in above, I know that 15 is the median. How can I use the UNIX command line to find it out automatically? My senior is advised me can use the 'awk' command line and the 'if' 'else' condition at the same time. Apart from that, perl also seem like can work. Hope any UNIX expert can help me solve this problem. Really thanks a lot for your help.

UNIX command line to solve the MEDIAN problem

patrick chia — Tue, 03 Feb 2009 10:30:15 +0800

My input:
10
15
20

My desired output:
Median = 15

**From the three figures in above, I know that 15 is the median. How can I use the UNIX command line to find it out automatically? My senior is advised me can use the 'awk' command line and the 'if' 'else' condition at the same time. Apart from that, perl seem like function also. Hope any UNIX expert can help me solve this problem. Really thanks a lot for your help.

URGENT:How to find out the median length in UNIX?

patrick chia — Fri, 30 Jan 2009 23:17:47 +0800

This is my original question.
My input is:
>gi|624954|emb|X83528.1|CLPSCD Chlorobium limicola pscD gene
GAAAAGAGGA
>gi|30271926|ref|NC_004718.3| SARS coronavirus, complete genome
ATATTAGGTTTTTAC
>gi|73852470|ref|NC_007346.1| Emiliania huxleyi virus 86
TATATTTAACGCGAATGATT

GAAAAGAGGA
ATATTAGGTTTTTAC
TATATTTAACGCGAATGATT

At the above three sequence, ATATTAGGTTTTTAC is the median and its length is 15. How can I use the unix script to automatic show that the length of the median is 15?What command line I should type? My senior got advise me to use the awk to solve this problem, but I no idea about how to type the command line in UNIX.

My desired output is:
The length of median:15

What command line I should used to find out the length of median in UNIX? Hope the UNIX expert can help me solve this problem. Really thanks a lot for your help....

URGENT: Unix Median and Average/Mean problem.

patrick chia — Fri, 30 Jan 2009 11:53:23 +0800

Median Problem:
GAAAAGAGGA
ATATTAGGTTTTTAC
TATATTTAACGCGAATGATT

At the above three sequence, ATATTAGGTTTTTAC is the median and its length is 15. How can I use the unix script to automatic show that the length of the median is 15?What command line I should type? My senior got advise me to use the awk to solve this problem, but I no idea about how to type the command line in UNIX.

Mean problem:
GAAAAGAGGA
ATATTAGGTTTTTAC
TATATTTAACGCGAATGATT

The average/mean length of the above nucleotide sequence is 15. How can I use the unix script to automatic calculate the average/mean length of the sequence is 15?What command line I should type?Any command line I also appreciated as long as can solve this two question.

Really thanks a lot of all of your advise and suggestion. I have spend few days to figure out this problem

Actually this is my original question.
My input is:
>gi|624954|emb|X83528.1|CLPSCD Chlorobium limicola pscD gene
GAAAAGAGGA
>gi|30271926|ref|NC_004718.3| SARS coronavirus, complete genome
ATATTAGGTTTTTAC
>gi|73852470|ref|NC_007346.1| Emiliania huxleyi virus 86
TATATTTAACGCGAATGATT

My desired output is:
The length of median:15
The mean of sequence:15

Hope any expert in UNIX can help me solve this problem...Really thanks a lot of all of your help...